View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16732_high_26 (Length: 337)
Name: NF16732_high_26
Description: NF16732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16732_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 12 - 219
Target Start/End: Original strand, 32191323 - 32191530
Alignment:
| Q |
12 |
ttctcatttcttgtttgctgacaaacaacgtgaacaacttcatgagacatagcttatggttatttattacttatggcttcttcctagtttgatgctgaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32191323 |
ttctcatttcttgtttgctgacaaacaacgtgaacaacttcatgagacatagcttatggttatttattacttatggcttcttcctagtttgatgctgaaa |
32191422 |
T |
 |
| Q |
112 |
tcgagagaaagatatgtatgtgatgacatgttgataataacttcacctgttaaaagaatgaaaatatgccaagtcgagctaggcatcacaaagtttaaat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32191423 |
tcgagagaaagatatgtatgtgatgacatgttgataataacttcacctgttaaaagaatgaaaatatgcgaagtcgagctaggcatcacaaagtttaaat |
32191522 |
T |
 |
| Q |
212 |
ttgggttt |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
32191523 |
ttgggttt |
32191530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 292 - 337
Target Start/End: Original strand, 32191603 - 32191648
Alignment:
| Q |
292 |
acctcagcaacaagaaaacctatgaagcattgacactcttggagtt |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32191603 |
acctcagcaacaagaaaacctatgaagcattgacactcttggagtt |
32191648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University