View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16732_high_41 (Length: 263)
Name: NF16732_high_41
Description: NF16732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16732_high_41 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 149 - 263
Target Start/End: Complemental strand, 26957792 - 26957678
Alignment:
| Q |
149 |
agacttttctaattgccattcacatgtccattttatgtttcagtttccaattgcatttttggtgtttggctttgaagcagtcaagttgtacaaggatcac |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26957792 |
agacttttctaattgccattcacatgtccattttatgtttcagtttccaattgcatttttggtgtttggctttgaagcagtcaagttgtacaaggatcac |
26957693 |
T |
 |
| Q |
249 |
agaatgaggatgggc |
263 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
26957692 |
agaatgaggatgggc |
26957678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 16 - 120
Target Start/End: Complemental strand, 26957933 - 26957829
Alignment:
| Q |
16 |
attacataaccaaacatattatgaattgcagtagtggtcgcagactcccagtctcatcgtgattcttgatattgcaaagaatcacgaacaaatgcaactt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26957933 |
attacataaccaaacatattatgaattgcagtagtggtcgcagactcccaatctcatcgtgattcttgatattgcaaagaatcacgaacaaatgcaactt |
26957834 |
T |
 |
| Q |
116 |
tagtt |
120 |
Q |
| |
|
||||| |
|
|
| T |
26957833 |
tagtt |
26957829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University