View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16732_high_51 (Length: 226)
Name: NF16732_high_51
Description: NF16732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16732_high_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 35473759 - 35473551
Alignment:
| Q |
1 |
caacattattattaataatattgttgttgtgatcaaataatgggtttggaggaattgaaagaaattggttaatattattatcaatgaagcaatcattgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35473759 |
caacattattattaataatattgttgttgtgatcaaataatggatttggaggaattgaaagaagttggttaatattattatcaatgaagcaatcattgat |
35473660 |
T |
 |
| Q |
101 |
aaggtcagaaccaaagttagatattgcatcttcatgctcacctcgaattaaatcgataaattgatcaaagtttggatcatcgatgaagtcatgcagctca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
35473659 |
aaggtcagaaccaaagttagatattgcatcttcatgctcacctcgaattaaatcgataaattgatcaaagtttggatcgtcaatgaagtcatgcagctca |
35473560 |
T |
 |
| Q |
201 |
aagttattg |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
35473559 |
aagttattg |
35473551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University