View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16732_high_55 (Length: 210)
Name: NF16732_high_55
Description: NF16732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16732_high_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 11 - 190
Target Start/End: Complemental strand, 45561937 - 45561758
Alignment:
| Q |
11 |
tccaagaatataccgatcacttaggttcgatgtagcctccatgactttgttaagaaggtgagaagtacctccattatcagtgaaatggacttgcttctta |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45561937 |
tccaataatataccgatcacttaggttcgatgtagcctccatgactttgttaagaaggtgagaagtacctccattatcagtgaaatggacttgcttctta |
45561838 |
T |
 |
| Q |
111 |
gattttctgccataagaaaagaaataaactaatcccagaagaagcaaaacaacagatattgaggatcctagagctatcat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45561837 |
gattttctgccataagaaaagaaataaactaatcccagaagaagcaaaacaacagatattgaggatcctagagctatcat |
45561758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University