View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16732_low_28 (Length: 328)
Name: NF16732_low_28
Description: NF16732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16732_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 148 - 318
Target Start/End: Original strand, 28711734 - 28711904
Alignment:
| Q |
148 |
ctacgtcggtggatgtatatttttgcttctcaagtcggtgactgttaattgatctatcaatattaaaagatcagttttatttttactcattattctgaac |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28711734 |
ctacgtcggtggatgtatatttttgcttctcaagtcggtgaatgttaattgatctatcaatattaaaagatcagttttatttttactcattattctgaac |
28711833 |
T |
|
| Q |
248 |
aaaagttggttagagtttgaacattaattaattaccgttttaaacaagaatgatatttttcttcttctgtg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
28711834 |
aaaagttggttagagtttgaacattaattaattactgttttaaacaagaatgatttttttcttcttctgtg |
28711904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 20 - 127
Target Start/End: Original strand, 28711594 - 28711701
Alignment:
| Q |
20 |
attctatcccatatgtggttccatatccttttcaatggggagctactacattttatgacggcgaaacattcaccatgttaatatcatctacgtcacttta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28711594 |
attctatcccatatgtggttccatatccttttcaatggggagctcctacattttatgatggcgaaacattcaccatgttaatatcatctacgtcatttta |
28711693 |
T |
|
| Q |
120 |
gcttcttc |
127 |
Q |
| |
|
|||||||| |
|
|
| T |
28711694 |
gcttcttc |
28711701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University