View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16732_low_39 (Length: 274)
Name: NF16732_low_39
Description: NF16732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16732_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 3 - 259
Target Start/End: Complemental strand, 8764056 - 8763798
Alignment:
| Q |
3 |
gacaataattatccaatgatgaaacgcgttataatatatactatatagtttttgaaggaatatttactatatagttatgttaggcgtgctaatatattaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8764056 |
gacaataattatccaatgatgaaacgcgttataatatatactatatagtttttgaaggaatatttactatatagttatgttaggcgtgctaatatattaa |
8763957 |
T |
|
| Q |
103 |
tcagtattctatattctttttgatatagttatacaataatattaaaaaagaatggatttatcactattccttcattgaaaagagtattcaatattccgtc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8763956 |
tcagtattctatattctttttgatatagttatacaataatattaaaaaagattggatttatcactattccttcattgaaaaaagtattcaatattccgtc |
8763857 |
T |
|
| Q |
203 |
tacac-tat-tttttggccaagctttactttttagcaagattgtgtgtacacaagtttt |
259 |
Q |
| |
|
||||| ||| ||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8763856 |
tacacttatctttttggtcaagctttagtttttagcaagattgtgtgtacacaagtttt |
8763798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University