View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16732_low_47 (Length: 255)
Name: NF16732_low_47
Description: NF16732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16732_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 31703970 - 31703722
Alignment:
| Q |
1 |
catgcccctgtcatagaaatnnnnnnntcagtcccttagagtaagacagaccatgcaatatgtcgatgtccaaaaatcatggttaaataggtttggtgga |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31703970 |
catgcccctgtcatagaaataaaaaaatcagtcccttagagtaagacagaccatgcaatatgtcgatgtccaaaaatcatggttaaataggtttggtgga |
31703871 |
T |
 |
| Q |
101 |
tggttaaccaagtatttgaactgtattaaccatgtaaattgtaatcgaaacttgctatcaaaatttgggtaaacatatcactaatcaaataccaaatata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31703870 |
tggttaaccaagtatttgaactgtattaaccatgtaaattgtaatcgaaacttgctatcaaaatttgggttaacatatcactaatcaaataccaaatata |
31703771 |
T |
 |
| Q |
201 |
caaaaaacacaattccaacctgcatattgcatgcaaccatctgtgctcc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31703770 |
caaaaaacacaattccaacctgcatattgcatgcaaccatctgagctcc |
31703722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 198 - 249
Target Start/End: Complemental strand, 31653429 - 31653378
Alignment:
| Q |
198 |
atacaaaaaacacaattccaacctgcatattgcatgcaaccatctgtgctcc |
249 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||| ||||||||||||| ||||| |
|
|
| T |
31653429 |
ataccaaaaacacaattctaacctgcatattgaatgcaaccatctgagctcc |
31653378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University