View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16732_low_51 (Length: 237)
Name: NF16732_low_51
Description: NF16732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16732_low_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 10072112 - 10071891
Alignment:
| Q |
1 |
aatagtagtagaaatggtttaatgaaggatgaaagaatcaagggtcaaggtgattgtagattttcatcttatggaaggaataattctttctatgctgaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10072112 |
aatagtagtagaaatggtttaatgaaggatgaaagaatcaagggtcaaggtgattgtagattttcatcttatggaaggaataattctttctatgctgaag |
10072013 |
T |
|
| Q |
101 |
ctattgcagattgtttggaattcatcaaaagaacatctatttcttctatggatcaaattcaagacccaattgtagtacatattcatgatagaaaaaactc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10072012 |
ctattgcagattgtttggaattcatcaaaagaacatctatttcttctatggatcaaattcaagacccaattgtagtacatattcatgatagaaaaaactc |
10071913 |
T |
|
| Q |
201 |
atgattcctttttgtttgtttg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
10071912 |
atgattcctttttgtttgtttg |
10071891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 64 - 164
Target Start/End: Original strand, 30696764 - 30696864
Alignment:
| Q |
64 |
tcatcttatggaaggaataattctttctatgctgaagctattgcagattgtttggaattcatcaaaagaacatctatttcttctatggatcaaattcaag |
163 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||| |||| |||||| ||||| |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30696764 |
tcatcttatggaaggtccaattctttttatgctgaagccattgaagattgcttggagttcatcaaaagaacatctatttcttctaaagatcaaattcaag |
30696863 |
T |
|
| Q |
164 |
a |
164 |
Q |
| |
|
| |
|
|
| T |
30696864 |
a |
30696864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University