View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16732_low_53 (Length: 226)

Name: NF16732_low_53
Description: NF16732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16732_low_53
NF16732_low_53
[»] chr2 (1 HSPs)
chr2 (1-209)||(35473551-35473759)


Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 35473759 - 35473551
Alignment:
1 caacattattattaataatattgttgttgtgatcaaataatgggtttggaggaattgaaagaaattggttaatattattatcaatgaagcaatcattgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
35473759 caacattattattaataatattgttgttgtgatcaaataatggatttggaggaattgaaagaagttggttaatattattatcaatgaagcaatcattgat 35473660  T
101 aaggtcagaaccaaagttagatattgcatcttcatgctcacctcgaattaaatcgataaattgatcaaagtttggatcatcgatgaagtcatgcagctca 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||    
35473659 aaggtcagaaccaaagttagatattgcatcttcatgctcacctcgaattaaatcgataaattgatcaaagtttggatcgtcaatgaagtcatgcagctca 35473560  T
201 aagttattg 209  Q
    |||||||||    
35473559 aagttattg 35473551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University