View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16732_low_58 (Length: 208)
Name: NF16732_low_58
Description: NF16732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16732_low_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 189
Target Start/End: Complemental strand, 2329773 - 2329600
Alignment:
| Q |
16 |
atgaagtagtcttgattataagtcttggataatcatccctttacatgtcagttttgtgagcctaacttacaaaatctattccaatcaaaattttctctca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2329773 |
atgaagtagtcttgattataagtcttggataatcatccctttacatgtcagttttgtgagcctaacttacaaaatctattccaatcacaattttctctca |
2329674 |
T |
|
| Q |
116 |
tatcaaattattcccaacgagaataacgacaaaaattatctatttttctgaagtgacgggcagaaattagtctt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2329673 |
tatcaaattattcccaacgagaataacgacaaaaattatctatttttctgaagtgacgggcagaaattagtctt |
2329600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 16 - 116
Target Start/End: Complemental strand, 47775703 - 47775602
Alignment:
| Q |
16 |
atgaagtagtcttgattataagtcttggataatcatccctttacatgtcagttttgtgagcctaacttac-aaaatctattccaatcaaaattttctctc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
47775703 |
atgaagtagtcttgattataagtcttggataatcatccctttacatgtcagttttgtgagcctaacttacaaaaatctattccaatcacaattttctctc |
47775604 |
T |
|
| Q |
115 |
at |
116 |
Q |
| |
|
|| |
|
|
| T |
47775603 |
at |
47775602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 112 - 189
Target Start/End: Complemental strand, 47775561 - 47775485
Alignment:
| Q |
112 |
ctcatatcaaattattcccaacgagaataacgacaaaaattatctatttttctgaagtgacgggcagaaattagtctt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
47775561 |
ctcatatcaaattattcccaacgagaataacgacaaaaattatctatttttgtgaagtgac-ggcagaaattagtctt |
47775485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University