View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16733_high_12 (Length: 298)
Name: NF16733_high_12
Description: NF16733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16733_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 8 - 280
Target Start/End: Original strand, 45974413 - 45974684
Alignment:
| Q |
8 |
agaagaagaagaagaacagcgaagaggacggtgtcggtaacggccaagtttccgtttgtttcttggtttgctacgtggcagcaagaggctcgtgagtgaa |
107 |
Q |
| |
|
||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45974413 |
agaagaagaagaacagcaacgaagaggacggtgtcggtaacggccaagtttccgtttgtttcttggtttgctacgtggc-gcaagaggctcgtgagtgaa |
45974511 |
T |
 |
| Q |
108 |
aatgccacatagagcaacttactttttcccgcgtcaatttccggagcgaggattggatgaatcatccaaaaagctattagatcaagataaggacaaaatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45974512 |
aatgccacatagagcaacttactttttcccgcgtcaatttccggagcgaggattggatgaatcatccaaaaagctattagatcaagataaggacaaaatc |
45974611 |
T |
 |
| Q |
208 |
gtcaactccatcaaatctccaatcgaaaacgacactccaaccacaaagtcactttcctcgtctactcctccaa |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45974612 |
gtcaactccatcaaatctccaatcgaaaacgacactccaaccacaaagtcactttcctcgtctactcctccaa |
45974684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University