View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16733_high_22 (Length: 237)
Name: NF16733_high_22
Description: NF16733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16733_high_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 5 - 223
Target Start/End: Original strand, 4557396 - 4557614
Alignment:
| Q |
5 |
tcgagtgagaagaataactttgggttaatgatttggcctggtgaatgaagtatctggttcgaatttcgatcactaactaaacttgatgatatgagtattt |
104 |
Q |
| |
|
|||||||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
4557396 |
tcgagtgaacagaataactttgggttaatgatatgacctggtgaatgaagtatctggttcgaatttcgatcactgactaaacctgatgatatgagtattt |
4557495 |
T |
 |
| Q |
105 |
ctgatatatacttatgatctggattcttgatgttattgacattgatgagtttttcatcagtccaatcaatttcttgcagaatttgagccactgagttctc |
204 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| ||| |||||||| || |
|
|
| T |
4557496 |
ctgatatatacttatgatcaggattcttgatgttattgacattgatgaatttttcatcagtccaatcaaattcttgcagaattttagcaactgagttttc |
4557595 |
T |
 |
| Q |
205 |
ctcactatcatcatcagtg |
223 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4557596 |
ctcactatcatcatcagtg |
4557614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University