View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16733_low_26 (Length: 237)
Name: NF16733_low_26
Description: NF16733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16733_low_26 |
 |  |
|
| [»] scaffold0450 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0450 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: scaffold0450
Description:
Target: scaffold0450; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 10056 - 9836
Alignment:
| Q |
1 |
tccacgaaccaaaccggacttttcattcaagcaaggtctaaaattcgtattttcatttcgacccgtaaaattaaacccaaagctatatggagtaacatta |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10056 |
tccatgaaccaaaccggacttttcattcaaccaaggtctaaaattcgtattttcatttcgacccgtaaaattaaacccaaagctatatggaataacatta |
9957 |
T |
 |
| Q |
101 |
tctaaccttcctttcttcgcagttcctgttcccacttcagttgatctaatcttgattgaagaaaaagtaacgttaggcaaaatgttagacttgcctgtag |
200 |
Q |
| |
|
|| ||| ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9956 |
tcaaactttcctttattcgtagttcctgttcccacttcagttgatctaatcttgattgaagaaaaagtaacgttaggcaaaatgttagacttgcttgtag |
9857 |
T |
 |
| Q |
201 |
atccaacgctccagttcttcc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9856 |
atccaacgctccagttcttcc |
9836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University