View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16733_low_32 (Length: 209)
Name: NF16733_low_32
Description: NF16733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16733_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 5 - 145
Target Start/End: Complemental strand, 54771698 - 54771558
Alignment:
| Q |
5 |
agcatcaactgcctgtaactcttctgcatcaaaactatcctcaatacagatagacataactctgctgtgcttcctccccttcttggtgaatgaatttttg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54771698 |
agcatcaactgcctgtaactcttctgcatcaaaactatcctcaatacagatagacataactctgctgtgcttcctccccttcttggtgaatgaatttttg |
54771599 |
T |
|
| Q |
105 |
aacttgctcgaggcactcaatgccaccttctttatagaccc |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54771598 |
aacttgctcgaggcactcaatgccaccttctttatagaccc |
54771558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 191
Target Start/End: Complemental strand, 54771540 - 54771512
Alignment:
| Q |
163 |
catcctcagaatgttccatctcatgacct |
191 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54771540 |
catcctcagaatgttccatctcatgacct |
54771512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University