View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16734_low_4 (Length: 322)
Name: NF16734_low_4
Description: NF16734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16734_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 242
Target Start/End: Complemental strand, 15117500 - 15117274
Alignment:
| Q |
16 |
cacaatgtaatcaacgtcagtgtatctaacttccatgtgtgcatcttgccattctccgtagaggatcaaaatcacgcggaaaattgcagagagtgtaaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
15117500 |
cacaatgtaatcaacgtcagtgtatctaacttccatgtgtgcatcttgccattctccgtagaggatcagaatcacgcggaaaattgcagagaatgtaaga |
15117401 |
T |
|
| Q |
116 |
agggaacgaatatctaaccatgccattggtgactgtttcgtcgccggtggtggcagaaggatctgagaagtttttgacggcggaggatacaatccggtta |
215 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15117400 |
agtgaacgaatatctaaccatgccattggtgactgtttcgtcgccggtggtggcagaaggatctgagaagtttttgacggcggaggatacaatccggtta |
15117301 |
T |
|
| Q |
216 |
actgagcaactaccgaacaaacccaat |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
15117300 |
actgagcaactaccgaacaaacccaat |
15117274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 263 - 321
Target Start/End: Complemental strand, 15117224 - 15117166
Alignment:
| Q |
263 |
gcttgtttaggtctgagttgagaaattgattctggaagcaaaactaattctagctttca |
321 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15117224 |
gcttgtttgggtctgagttgagaaattgattctggaagcaaaactaatcctagctttca |
15117166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 20 - 78
Target Start/End: Original strand, 25633833 - 25633891
Alignment:
| Q |
20 |
atgtaatcaacgtcagtgtatctaacttccatgtgtgcatcttgccattctccgtagag |
78 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25633833 |
atgtaatcaacgtcagtgtatcgaacttccatgtgtgcatcttgccattctccatagag |
25633891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University