View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16734_low_5 (Length: 266)
Name: NF16734_low_5
Description: NF16734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16734_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 258
Target Start/End: Original strand, 44136741 - 44136980
Alignment:
| Q |
17 |
agatatctcaacttggagccgagaagctgcaccaaattacagacatctaatccggaaacaatgcgnnnnnnntagaggagttccgcaatgctatgtgtga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
44136741 |
agatatctcaacttggagccgagaagctgcaccaaattacagacatctaatccggaaacaacgcgaaaaaaatagaagagttccgcaatgctatgtgtga |
44136840 |
T |
|
| Q |
117 |
tggtaacgacccgcaattggaaagtatgcagaaaaatctcgcttctctaattctacaagaggaaacttactggcgtcaacgttctaaggtctattggtta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44136841 |
tggtaacgacccgcaattggaaagtatgcagaaaaatctcgcttctttaattctacaagaggaaacttactggcatcaacgttctaaggtctattggtta |
44136940 |
T |
|
| Q |
217 |
gcagacggcgacactaatagcaagttcttccatgcctatgct |
258 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
44136941 |
gtagacg--gacactaatagcaagttcttccatgcctctgct |
44136980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University