View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16734_low_8 (Length: 225)
Name: NF16734_low_8
Description: NF16734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16734_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 46006952 - 46007171
Alignment:
| Q |
1 |
agttaaaatcaatttagatcggattccataaaagtaaagtgttagactttcacaacgcaacatactg-----------ctgcga--gagaattaatacta |
87 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
46006952 |
agttaaaatcaatttagatcggatcagataaaagtaaagtgttagactttcacaacgcaacaaactataattcaaatcctgcgaaagagaattaatacta |
46007051 |
T |
 |
| Q |
88 |
ctcgacatacattaaaaaagaagcagaaagtgagagtgagccagaggtgcgtggtcacatcttgctcatgatttcttaattccattactcatctgagttc |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46007052 |
ctcgacatacattaaaaaagaagcagaaagtgagagtgagccagaggtgcgtggtcatatcttgctcatgatttcttaattccattactcatctgagttc |
46007151 |
T |
 |
| Q |
188 |
ccaatgagctgcagcagggt |
207 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
46007152 |
ccaatgagctgcagcagggt |
46007171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University