View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16735_high_108 (Length: 216)
Name: NF16735_high_108
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16735_high_108 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 7724315 - 7724502
Alignment:
| Q |
17 |
catgaaatactatacatatttgttgtttttatttatatatatttttgctgaattccataccacacacgttcatatacacgaatactgataggtatgtaca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7724315 |
catgaaatactatacatatttgttgtttttatttatatatatttttgctgaattccacaccacacacgttcatatacacgaatacagataggtatgtaca |
7724414 |
T |
 |
| Q |
117 |
gtactgatggtggattggatttaattggtttgaagcaaatctgatggtccaaatccaatgccaatgtttagaatcactgttgtctctg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7724415 |
gtactgatggtggattggatttaattggtttgaagcaaatctgatggtccaaatccaatgccattgtttagaatcactgttgtctctg |
7724502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University