View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16735_high_50 (Length: 369)
Name: NF16735_high_50
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16735_high_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 86; Significance: 5e-41; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 21 - 114
Target Start/End: Complemental strand, 49424105 - 49424012
Alignment:
| Q |
21 |
aagcaaacatatcgactgcatgtacatacccactacaaagaaaaagaaaagcaagcatacaaataggtacacgaagaaagacacgtgacttggg |
114 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49424105 |
aagcaaaaatatccactgcatgtacatacccactacaaagaaaaagaaaagcaagcatacaaataggtacacgaagaaagacacgtgacttggg |
49424012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 49423943 - 49423847
Alignment:
| Q |
183 |
ttgaaactatgaagcttcattccattgcataaaccccaat-gggggaatgtaaaattgaagaattagtggaatggggtggaatgagttccattatgt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
49423943 |
ttgaaactatgaagcttcattccattgcataaaccccaattgggggaatgtaaaattgaagaattaatggaatgaggtggaatgagttccattatgt |
49423847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 297 - 354
Target Start/End: Complemental strand, 49423845 - 49423788
Alignment:
| Q |
297 |
tcattccattacattcaccttttgctatccaaacaatgaaatcaaattatttaccact |
354 |
Q |
| |
|
||||||||||||||| || ||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
49423845 |
tcattccattacatttactttttgctattcaaacaatgaaatcaaattagttaccact |
49423788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University