View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16735_low_117 (Length: 212)
Name: NF16735_low_117
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16735_low_117 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 41 - 163
Target Start/End: Original strand, 2653017 - 2653139
Alignment:
| Q |
41 |
ttttagcattctatctaacaaataaaaacaataactatcagaaacttaatgggacagacaatgttgaggaaggagaaatcacataagctaaaatattacc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2653017 |
ttttagcattctatctaacaaataaaaacaataactatcaaaaacttgatgggacagacaatgttgaggaaggagaagtcacataagctaaaatattacc |
2653116 |
T |
 |
| Q |
141 |
tttctattttgcttcaatttcct |
163 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2653117 |
tttctattttgcttcaatttcct |
2653139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 164 - 196
Target Start/End: Original strand, 2653156 - 2653188
Alignment:
| Q |
164 |
cagaccagaaaacacatttcactctgtgtgact |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2653156 |
cagaccagaaaacacatttcactctgtgtgact |
2653188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 87
Target Start/End: Original strand, 1548426 - 1548495
Alignment:
| Q |
17 |
ctgtggagagatgagcaacttcaattttagcattctatctaacaaataaaaacaataactatcagaaactt |
87 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| ||||| || ||||| | |||||||||||||| |||||| |
|
|
| T |
1548426 |
ctgtagagagatgagcaacttcaatgttagccttctacctgacaaa-cagaacaataactatcaaaaactt |
1548495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University