View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16735_low_120 (Length: 209)
Name: NF16735_low_120
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16735_low_120 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 59 - 192
Target Start/End: Original strand, 19275348 - 19275481
Alignment:
| Q |
59 |
tttttatctcttggttatcaagtttttctcttgtgaattgatgtactagttttaccaagtgaaaacttttaagtttcagcttcaaggaagatgataaaga |
158 |
Q |
| |
|
|||| |||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19275348 |
ttttcatcttttggtaatcaagtttttctcttgtgaattgatttactagttttaccaagtgaaaacttttaagtttcagcttcaaggaagatgataaaga |
19275447 |
T |
|
| Q |
159 |
tctgaaccttgatcataactttgcatgcatggct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19275448 |
tctgaaccttgatcataactttgcatgcatggct |
19275481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University