View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16735_low_124 (Length: 206)
Name: NF16735_low_124
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16735_low_124 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 136 - 190
Target Start/End: Original strand, 31085317 - 31085371
Alignment:
| Q |
136 |
agaactcattaagaaacttgtatgctgattttaccgagaattcacattttttatt |
190 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31085317 |
agaactcattaagaaacttgtatgccgattttaccgagaattcacattttttatt |
31085371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University