View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16735_low_22 (Length: 445)
Name: NF16735_low_22
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16735_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 7e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 7e-87
Query Start/End: Original strand, 2 - 164
Target Start/End: Complemental strand, 44782235 - 44782073
Alignment:
| Q |
2 |
ttatgtgcatttcaatcatatcacgttactgtttcattatacttaaaaataaatttttgaccgctttaggagctttctagttatcgaggagtgtgtaaag |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44782235 |
ttatgtgcatttcaatcatatcacgttactgtttcattatacttaaaaataaatttttgaccgctttaggagctttctagttatcgaggagtgtgtaaag |
44782136 |
T |
 |
| Q |
102 |
acacaaatttatgcacaagatctacttagtgttcttcgtaagtagtatatcaagcaccttact |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44782135 |
acacaaatttatgcacaagatctacttagtgttcttcgtaagtagtatatcaagcaccttact |
44782073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University