View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16735_low_40 (Length: 408)
Name: NF16735_low_40
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16735_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 45603256 - 45603487
Alignment:
| Q |
18 |
aaatcacggcgagcgagcgagcgagagagtgaaactgaaacacagaagggttaattcttcgattcatcatgtaacacgtggacaattcaaggtggttgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45603256 |
aaatcacggcgagcgagcgagcgagagagtgaaactgaaacacagaagggttaattcttcgattcatcgtgtaacacgtggacaattcaaggtggttgga |
45603355 |
T |
 |
| Q |
118 |
tcacgacatattggtgtcaaacgtgtcatatcagttactgcttagatttcttcatttatttctcnnnnnnnnnnncttatttaattaatttttattaata |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
45603356 |
tcacgaaatattggtgtcaaacgtgtcatatcagttactgcttagatttcttcatttatttctc-ttttttttttcttatttaattaattcttattaata |
45603454 |
T |
 |
| Q |
218 |
atccaaaaataaaaattgatcagacaatattaa |
250 |
Q |
| |
|
|||||||||||||||||||||| || ||||||| |
|
|
| T |
45603455 |
atccaaaaataaaaattgatcacacgatattaa |
45603487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 257 - 351
Target Start/End: Original strand, 45603518 - 45603612
Alignment:
| Q |
257 |
atattataactatgaattttgaatatgttaagatctaaccactacgctattggacnnnnnnnnttataaatataactatgaattttttgtaccaa |
351 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45603518 |
atattataactatgaattttgaacatgttaagatctaatcactacgctactggacatcaaaaattataaatataactatgaattttttgtaccaa |
45603612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University