View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16735_low_41 (Length: 406)
Name: NF16735_low_41
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16735_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 108 - 400
Target Start/End: Complemental strand, 10397144 - 10396854
Alignment:
| Q |
108 |
gttattgttgaattttgttgtcagatttgtgtctcaaaatataatcctcgattttgaaaacagttgtttgtcttttttaagagattagtttttgagactt |
207 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10397144 |
gttattgttgaattttgttatcagatttgtgtctcaaaatataatcctcgattttgaaaacagttgtttgtctttattaagagattagtttttgagactt |
10397045 |
T |
 |
| Q |
208 |
tatctacaaaatgaaaaaagagatcagtttttgacttgctagtagaaaatacccnnnnnnngacaaaaagtataaaaataccctcaatagctaaaaatac |
307 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10397044 |
tatctacaaaatgaaaaatgagataagtttttgacttgctagtagaaaata-ccattttttgacaaaaagtataaaaataccctcaatagctaaaaatac |
10396946 |
T |
 |
| Q |
308 |
aaaatgtgacatctaagacannnnnnnnaattacataacccctatcactcctatctgttgctaaaactctccaccaagaaatttgatgatgtc |
400 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10396945 |
aaaatgtgacatctaagaca-tttttttaattacataacccctatcactcctatctgttgctaaaactctccaccaagaaatttaatgatgtc |
10396854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University