View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16735_low_58 (Length: 354)
Name: NF16735_low_58
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16735_low_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 4 - 336
Target Start/End: Original strand, 9501249 - 9501581
Alignment:
| Q |
4 |
ttgtcattgcaatgctcttcatcaattgcttttgtcatcagttgtaataagttttattttctgtctaccactgtttgtggaaaaatattctttaagaatt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9501249 |
ttgtcattgcaatgctcttcatcaattgcttttgtcatcagttgtaataaattttattttctgtctaccactgtttctggaaaaatattctttaagaatt |
9501348 |
T |
|
| Q |
104 |
taagtaggatgccttatcaattttttgtcgtgttttcttgaactctggactttctcacttgagaaaagggtagtacgtatcttctaaacttgtttttgct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9501349 |
taagtaggatgccttatcaattttttgtcgtgttttcttgaactctggactttctcacttgagaaaagggtagtacgtatcttctaaacttgtttttgct |
9501448 |
T |
|
| Q |
204 |
tttgttttgtatgcaggtattattaattatacgttttcttcagcatgagcaccatcttggccggccaatcaaccaagtaaacatctagcttttcatttat |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9501449 |
tttgttttgtatgcaggtattattaattatacgttttcttcagcatgagcaccatcttggccggccaatcaaccaagtaaacatctagcttttcatttat |
9501548 |
T |
|
| Q |
304 |
tccactctatatctgttgatagccacccaggac |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9501549 |
tccactctatatctgttgatagccacccaggac |
9501581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University