View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16735_low_70 (Length: 305)
Name: NF16735_low_70
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16735_low_70 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 22 - 295
Target Start/End: Original strand, 14392244 - 14392517
Alignment:
| Q |
22 |
caaggaggagacgaggttttataaccccttgtttttgggttagagattaataagatgatgtttttatattgctgagtcaaacttgccaaatcacaccctt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14392244 |
caaggaggagacgaggttttataaccccttatttttgggttagagattaataagatgatgtttttatattgttgagtcaaacttgccaaatcacaccctt |
14392343 |
T |
|
| Q |
122 |
aatgtgcaaataattttttcacggtttgtccaaatannnnnnncaacatggacggaggtagtaatttaaattttgagtctggccaaatctaaaattatag |
221 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14392344 |
aatgtgcaaatagttttttcacggtttgtccaaatatatttttcaacatggacggaggtagtaatttaaattttgagtttggccaaatctaaaattatag |
14392443 |
T |
|
| Q |
222 |
gatcaaatttatatcttttatctttaccaagattattcctctgccagatgccaacaactcaagacgtacctatg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |||||| | || ||||||||||||||||||||||||||| |
|
|
| T |
14392444 |
gatcaaatttatatcttttatctttaccatgattgttcctccgtcaaatgccaacaactcaagacgtacctatg |
14392517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University