View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16735_low_79 (Length: 276)
Name: NF16735_low_79
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16735_low_79 |
 |  |
|
| [»] scaffold0201 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 254
Target Start/End: Complemental strand, 23381903 - 23381647
Alignment:
| Q |
10 |
aaatgaagatgacaaggaacaacctttctattagtagacccaagtttgtgtaattgtat--ttgtatgtttagacaaagttatttattacagcacttgta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23381903 |
aaatgaagatgacaaggaacaacctttctattagtagacccaagtttgtgtaattgtatgtttgtatctttagacaaagttatttattacagcacttgta |
23381804 |
T |
 |
| Q |
108 |
atttccccat----------atatccgctcaaagttaccagtttcattctatctattactctcccaaatatcaaagaactgtcgaacattccacgttagt |
197 |
Q |
| |
|
| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23381803 |
acttccccatgtttctctaaatatccgctcaaagttaacagtttcattctatctattactctcccaaatatcaaagaactgtcgaacattccacgttagt |
23381704 |
T |
 |
| Q |
198 |
tttctcttggttgcattttgagcttcagcaaatacaatagaacagaataacattaca |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23381703 |
tttctcttggttgcattttgagcttcagcaaatacaatagaacagaataacattaca |
23381647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0201 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0201
Description:
Target: scaffold0201; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 135 - 177
Target Start/End: Complemental strand, 9678 - 9636
Alignment:
| Q |
135 |
ccagtttcattctatctattactctcccaaatatcaaagaact |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9678 |
ccagtttcattctatctattactctcccaaatatcaaagaact |
9636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University