View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16735_low_86 (Length: 257)
Name: NF16735_low_86
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16735_low_86 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 99 - 237
Target Start/End: Complemental strand, 40717784 - 40717646
Alignment:
| Q |
99 |
gagagaaagatagaatgttattaaaacaactaaaaattttataacgtattttacgtagtataaaattatactacttattgatttgatttgaggagagaaa |
198 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40717784 |
gagagaaagatagaatgttatttaaacaactaaaaattttataacgtattttacgtagtataaaattaaactacttattgatttgatttgaggagagaaa |
40717685 |
T |
 |
| Q |
199 |
aataataattagaaacataattgtatttggggtttgtta |
237 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40717684 |
aataataattagaaacataattgtatctggggtttgtta |
40717646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 40717894 - 40717813
Alignment:
| Q |
1 |
aaaatttactttcctcacgcggcacacgtcttagcttgaggatctgtccttttatttattctacaacattttcagaagatag |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40717894 |
aaaatttactttcctcacgcggcacacgtcttagcttgaggatctgtccttttatttattctacaacattttcagaagatag |
40717813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University