View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16735_low_87 (Length: 256)

Name: NF16735_low_87
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16735_low_87
NF16735_low_87
[»] chr1 (1 HSPs)
chr1 (49-238)||(44990167-44990356)
[»] chr2 (1 HSPs)
chr2 (11-70)||(30156527-30156586)


Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 49 - 238
Target Start/End: Complemental strand, 44990356 - 44990167
Alignment:
49 tgtataaaatagtgttctgtttattaaattgcaagaaaatgatcacttctttataattctttgtgggttgaataaaaatcttgaagaagtgagtggcaga 148  Q
    ||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||    
44990356 tgtataaaatagtgttctgtttattaaattgcaagaaaatgataatttctttataattctttgtgggtggaataaaaatcttgaagaagtgagtggcaga 44990257  T
149 atattggggaagatgccactaccaactatttatgaaatgttttcaggaataaaggagagacgaggcaggacaaaaaatcgtgatgggtaa 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
44990256 atattggggaagatgccactaccaactatttatgaaatgttttcaggaataaaggagagacgaggcaggacaaaaaatcttgatgggtaa 44990167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 70
Target Start/End: Original strand, 30156527 - 30156586
Alignment:
11 caagaattggatctttgttatgatgacaattagaggtgtgtataaaatagtgttctgttt 70  Q
    ||||| |||||||| |||||||||||||||| ||||||| || || ||||||||||||||    
30156527 caagagttggatctctgttatgatgacaattggaggtgtatagaagatagtgttctgttt 30156586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University