View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16735_low_87 (Length: 256)
Name: NF16735_low_87
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16735_low_87 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 49 - 238
Target Start/End: Complemental strand, 44990356 - 44990167
Alignment:
| Q |
49 |
tgtataaaatagtgttctgtttattaaattgcaagaaaatgatcacttctttataattctttgtgggttgaataaaaatcttgaagaagtgagtggcaga |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44990356 |
tgtataaaatagtgttctgtttattaaattgcaagaaaatgataatttctttataattctttgtgggtggaataaaaatcttgaagaagtgagtggcaga |
44990257 |
T |
|
| Q |
149 |
atattggggaagatgccactaccaactatttatgaaatgttttcaggaataaaggagagacgaggcaggacaaaaaatcgtgatgggtaa |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44990256 |
atattggggaagatgccactaccaactatttatgaaatgttttcaggaataaaggagagacgaggcaggacaaaaaatcttgatgggtaa |
44990167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 11 - 70
Target Start/End: Original strand, 30156527 - 30156586
Alignment:
| Q |
11 |
caagaattggatctttgttatgatgacaattagaggtgtgtataaaatagtgttctgttt |
70 |
Q |
| |
|
||||| |||||||| |||||||||||||||| ||||||| || || |||||||||||||| |
|
|
| T |
30156527 |
caagagttggatctctgttatgatgacaattggaggtgtatagaagatagtgttctgttt |
30156586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University