View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16735_low_95 (Length: 248)
Name: NF16735_low_95
Description: NF16735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16735_low_95 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 7 - 131
Target Start/End: Original strand, 9997332 - 9997456
Alignment:
| Q |
7 |
gtgagatgaaatgaagaggaagaagaaagatgatagaggctataattctcaagttgacagagaagacaacgaagttgctgttggttttaaccaaagaata |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9997332 |
gtgaaatgaaatgaagaggaagaagaaagatgatagaggctataattctcaagttgacagagaagacaacgaagttgctgttggttttaaccaaagaata |
9997431 |
T |
 |
| Q |
107 |
ttagagaatattctatatgtttcac |
131 |
Q |
| |
|
||||||||||||||||||| ||||| |
|
|
| T |
9997432 |
ttagagaatattctatatgattcac |
9997456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University