View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16736_low_9 (Length: 229)
Name: NF16736_low_9
Description: NF16736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16736_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 88 - 220
Target Start/End: Complemental strand, 9047470 - 9047338
Alignment:
| Q |
88 |
ttctagcaatgatggtagcacagaagtttctaatgtaaatgtaatatggtatcttccgataatttcaagattnnnnnnnnttgtttactaatgtaaatga |
187 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9047470 |
ttctagcaatgatggtagcataaaagtttctaatgtaaatgtaatatggtatcttccgataatttcaagattaaaaaaaattgtttactaatgtaaatga |
9047371 |
T |
 |
| Q |
188 |
cataaagtatatatgtaacatgctgatgagaag |
220 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
9047370 |
cataaagtatatatgcaacatgctgatgagaag |
9047338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University