View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16736_low_9 (Length: 229)

Name: NF16736_low_9
Description: NF16736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16736_low_9
NF16736_low_9
[»] chr6 (1 HSPs)
chr6 (88-220)||(9047338-9047470)


Alignment Details
Target: chr6 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 88 - 220
Target Start/End: Complemental strand, 9047470 - 9047338
Alignment:
88 ttctagcaatgatggtagcacagaagtttctaatgtaaatgtaatatggtatcttccgataatttcaagattnnnnnnnnttgtttactaatgtaaatga 187  Q
    |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||    
9047470 ttctagcaatgatggtagcataaaagtttctaatgtaaatgtaatatggtatcttccgataatttcaagattaaaaaaaattgtttactaatgtaaatga 9047371  T
188 cataaagtatatatgtaacatgctgatgagaag 220  Q
    ||||||||||||||| |||||||||||||||||    
9047370 cataaagtatatatgcaacatgctgatgagaag 9047338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University