View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16739_high_12 (Length: 271)
Name: NF16739_high_12
Description: NF16739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16739_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 256
Target Start/End: Original strand, 47899806 - 47900045
Alignment:
| Q |
16 |
ataattgttgctgtttaaaaaagcaataaagaatgattattatagaaattatcaacaaatgaatagtgagcaaagtgaaagaatcataattaatcatgaa |
115 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47899806 |
ataattgttgctgtttaacaaagcaataaagaatgattattatagaaattatcaacaaatgaatagtgagcaaagtgaaataatcataattaatcatgaa |
47899905 |
T |
 |
| Q |
116 |
agtataaagcattacaaagaggaatataccttgcatagtaggcagcgacggcagccaagtagacagagtgaatccatttaggggaagtgctatgaaacgc |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47899906 |
agtataaagcattacaa-gaggaatataccttgcatagtaggcagcgacggcagccaagtagacagagtgaatccatttaggggaagtgctatgaaacgc |
47900004 |
T |
 |
| Q |
216 |
aaccttccataactgaacatgcttaaccatgaatttatatt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47900005 |
aaccttccataactgaacatgcttaaccatgaatttatatt |
47900045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University