View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16739_low_16 (Length: 246)
Name: NF16739_low_16
Description: NF16739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16739_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 63 - 216
Target Start/End: Complemental strand, 13049963 - 13049808
Alignment:
| Q |
63 |
ttcgaatgttctctattcacttcaagtttttagaaaaaacgttttaacaaaatttaacaagtgaaaggaaataaaaatgaattacaagtttatgtaatta |
162 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13049963 |
ttcgaatgttctctattctactcaaatttttagcaaaaatgttttaacaaaatttaacaagtgaaaggaaataaaaatgtattacaagtttatgtaatta |
13049864 |
T |
|
| Q |
163 |
caatgtctaac--tttttgaaagttcacttattaaaatttgggttaagagtttgat |
216 |
Q |
| |
|
||||||| ||| ||||||||||| |||| | |||| |||||||||||||||||| |
|
|
| T |
13049863 |
caatgtcgaacaagttttgaaagtttacttgtaaaaaattgggttaagagtttgat |
13049808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University