View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16739_low_6 (Length: 468)
Name: NF16739_low_6
Description: NF16739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16739_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 103 - 450
Target Start/End: Complemental strand, 40033790 - 40033452
Alignment:
| Q |
103 |
tatctaactatcctaaatgataagaacacatcaaatagaaatgaaattgtaccctaaattgtgcgaaagaaatttaccttgaatgaagttactcagaaac |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40033790 |
tatctaactatcctaaatgataagaacacatcaaatagaaacgaaattgtaccctaaattgtgagaaagaaatttaccttgaatgaagttactcagaaac |
40033691 |
T |
|
| Q |
203 |
cctagaaccggtagagaaaatgaaatggtgagagaataaacagggttacatgatttatatggtgcagcgtcgtttttctttattttgacggaattgccct |
302 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40033690 |
cctaga---------gaaaatgaaatggtgagagaataaacagggttacatgatttatatggtgcagcgtcgtttttctttattttgacggaattgccct |
40033600 |
T |
|
| Q |
303 |
ttgtttttgcatgcaccgccactctctgagccccctataatatactgccatgatttctggcttcaacacaaagctggttgagaaaacttatttttggcaa |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40033599 |
ttgtttttgcatgcaccgccactctctgagccccctataatatactgccatgatttctggcttcaacacaaagctggttgagaaaacttatttttggcaa |
40033500 |
T |
|
| Q |
403 |
taactgatactatcataacaatgtatgtctttgacattaatatcatgt |
450 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40033499 |
taattgatactatcataacaatgtatgtctttgacattaatatcatgt |
40033452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 25 - 65
Target Start/End: Complemental strand, 40033874 - 40033834
Alignment:
| Q |
25 |
cataaacttaagcataaacattattatcatgatcgaatacg |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40033874 |
cataaacttaagcataaacattattatcatgatcgaatacg |
40033834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 352 - 398
Target Start/End: Complemental strand, 40039170 - 40039124
Alignment:
| Q |
352 |
atgatttctggcttcaacacaaagctggttgagaaaacttatttttg |
398 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40039170 |
atgatatctggcttcaacaccaagctggttgagaaaacttatttttg |
40039124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University