View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16739_low_8 (Length: 354)
Name: NF16739_low_8
Description: NF16739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16739_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 13 - 347
Target Start/End: Original strand, 2725658 - 2725992
Alignment:
| Q |
13 |
caattcgatcaatagagtcgtcgatttctttcattgtgatcttctctttttgccttcgaccggctagaatggctgcttcattcatgaggtttgccaggtc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2725658 |
caattcgatcaatagagtcgtcgatttctttcattgtgatcttctctttttgccttcgaccagctagaatggctgcttcattcatgaggtttgccaggtc |
2725757 |
T |
 |
| Q |
113 |
cgcaccgctgaatcctggagttctcatggcaatgacaccgagtgagatatctttgtcaagcttcttgttgttactatgaactttcaatatttcttccctc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2725758 |
cgcaccgctgaatcctggagttctcatggcaatgacaccgagtgagatatctttgtcaagcttcttgttgttactatgaactttcaatatttcttccctc |
2725857 |
T |
 |
| Q |
213 |
cctctaatgtctggtaatccaacagttacctattgtaacaatcacaaaattattgttagaatagtaaatgcggttctaaagtaagaagataaacacatga |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
2725858 |
cctctaatgtctggtaatccaacagttacctattgtaacaatcacaaaattattgttagaatagtaaatgcggttctaaagtaagaagatgaacacacga |
2725957 |
T |
 |
| Q |
313 |
gaatataaggattgatcttgagttcgacgcctatg |
347 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2725958 |
gaataaaaggattgatcttgagttcgacgcctatg |
2725992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University