View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16740_high_4 (Length: 317)
Name: NF16740_high_4
Description: NF16740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16740_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 22 - 205
Target Start/End: Complemental strand, 35787141 - 35786958
Alignment:
| Q |
22 |
ctgataacaacaaattcagataccgtggtgtaagacaacgtagttggggtaaatgggttgctgaaattcgtgaaccacgtaaacgtactcgtaaatggct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35787141 |
ctgataacaacaaattcagataccgtggtgtaagacaacgtagttggggtaaatgggttgctgaaattcgtgaaccacgtaaacgtactcgtaaatggct |
35787042 |
T |
|
| Q |
122 |
tggtactttttcaactgctgaagatgctgctaaagcttatgatcgtgctgctattattctctatggttctagggctcagcttaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35787041 |
tggtactttttcaactgctgaagatgctgctaaagcttatgatcgtgctgctattattctctatggttctagggctcagcttaa |
35786958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 65 - 98
Target Start/End: Complemental strand, 25896674 - 25896641
Alignment:
| Q |
65 |
ttggggtaaatgggttgctgaaattcgtgaacca |
98 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
25896674 |
ttggggtaaatgggttgctgagattcgtgaacca |
25896641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 65 - 97
Target Start/End: Original strand, 52690554 - 52690586
Alignment:
| Q |
65 |
ttggggtaaatgggttgctgaaattcgtgaacc |
97 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
52690554 |
ttggggtaaatgggttgctgaaatccgtgaacc |
52690586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University