View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16740_low_5 (Length: 286)
Name: NF16740_low_5
Description: NF16740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16740_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 22 - 152
Target Start/End: Complemental strand, 36026563 - 36026431
Alignment:
| Q |
22 |
cttacaaatacaaaaacagaaattaaacaggctatgtatccagacaagtttcatacttatccaactggggttgaaaaatggcatcatc--atattcagaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36026563 |
cttacaaatacaaaaacagaaattaaacaggctatgtatccagacaagtttcatacttatccaactggggttgaaaaatggcatcatcatatattcagaa |
36026464 |
T |
|
| Q |
120 |
cgagccctgatttttcaaaatgaacttaactgc |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36026463 |
cgagccctgatttttcaaaatgaacttaactgc |
36026431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 214 - 266
Target Start/End: Complemental strand, 36026369 - 36026317
Alignment:
| Q |
214 |
ccaggtaaggataaggttggatgatccaatagggaagtgcagagaagcctagg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36026369 |
ccaggtaaggataaggttggatgatccaatagggaagtgcagagaagcctagg |
36026317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 27 - 145
Target Start/End: Original strand, 16933824 - 16933951
Alignment:
| Q |
27 |
aaatacaaaaacagaaattaaacaggctatgtatccagacaagtttcatacttatccaactggggttgaaaaatggcatc---------atcatattcag |
117 |
Q |
| |
|
||||||||||| |||| |||||||||||| |||||||||| ||| ||| |||||||||| || |||||||||||| | ||||||||||| |
|
|
| T |
16933824 |
aaatacaaaaaagaaaataaaacaggctatgaatccagacaaatttaatagttatccaactatggctgaaaaatggcagcatatcatatatcatattcag |
16933923 |
T |
|
| Q |
118 |
aacgagccctgatttttcaaaatgaact |
145 |
Q |
| |
|
||| ||| ||| |||||||||||||||| |
|
|
| T |
16933924 |
aacaagcactggtttttcaaaatgaact |
16933951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University