View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16741_high_25 (Length: 416)
Name: NF16741_high_25
Description: NF16741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16741_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 20 - 402
Target Start/End: Original strand, 54898044 - 54898425
Alignment:
| Q |
20 |
attgtttctcgcactacgtggcaatgctcnnnnnnnattatacgttcatctaatatcatacagaacaagaagaccttagctgtattttggtatagagtaa |
119 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
54898044 |
attgtttctcgcactacgtagcaatgctatttttttattatacgttcatctaatatcatac-gaacaagaagaccttagctgtattttgatatagagtaa |
54898142 |
T |
 |
| Q |
120 |
atgattcttatttctaaaatttcttatttcataattgttgttggtcaaacgacacttaactgtcgttgtcatttgtctctccaacaataattaagtgtca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54898143 |
atgattcttatttctaaaatttcttatttcataattgttgttggtcgaacgacacttaactgtcattgtcatttgtctctccaacaataattaagtgtca |
54898242 |
T |
 |
| Q |
220 |
tttgccannnnnnnnatcatatgaatcactttttaaacccatttaaaaatatcttggaagtcagctaagttaattgttgttaggggtaaataggtaattt |
319 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54898243 |
tttgctattttttagatcatatgaatcactttttaaacccatttaaaaatatcttgaaagtcagctaagttaattgttgttaggggtaaataggtaattt |
54898342 |
T |
 |
| Q |
320 |
taagatggattgaagaatttttgaaagcctaaagattaatacacggttggcaatgatccggtggtatggcgtgatgcttgatg |
402 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
54898343 |
tgagatggattgaagaatttttgaaagcctaaagattaatacacggttggcaatgatccggtggtatagcgtgatgcttgatg |
54898425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University