View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16741_high_46 (Length: 292)
Name: NF16741_high_46
Description: NF16741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16741_high_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 18 - 281
Target Start/End: Original strand, 2341572 - 2341835
Alignment:
| Q |
18 |
agcatcagtttcaacaaaatcaacactcgctccttcaacagccaaatccaccgttccagagatctttgctcagtgcaaatcagctgttgcatttaaacag |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
2341572 |
agcatcagcttcaacaaaatcaacactcgctccttcaacagccaaatccaccgttccagagatctttgctcagtgcaaatcagctgtcgcatttaaaaag |
2341671 |
T |
 |
| Q |
118 |
ggttggacagaattcaaacatgccattaggtaatcgctagtttcaccgccacggctctaccatgggagttccattgttgagccaacaaacacatcagcaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2341672 |
ggttggacagaattcaaacatgccattaggtaatcgctagtttcaccgccacggctctaccatgggagttccattgttgagccaacaaacacatcagcaa |
2341771 |
T |
 |
| Q |
218 |
gcaagccctcggcagatgagtcaacgaactccgatgagtccgcaacaaatgaggagcaattcat |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2341772 |
gcaagccctcggcagatgagtcaacgaactccgatgagtccgcaacaaatgaggagcaattcat |
2341835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 27 - 152
Target Start/End: Original strand, 7751761 - 7751886
Alignment:
| Q |
27 |
ttcaacaaaatcaacactcgctccttcaacagccaaatccaccgttccagagatctttgctcagtgcaaatcagctgttgcatttaaacagggttggaca |
126 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
7751761 |
ttcaacagaatcaacactctctccttcaacagcaaaatccacaattccagagatctttgctcagtgcaaatcagctttcacatttaaacggggttggaca |
7751860 |
T |
 |
| Q |
127 |
gaattcaaacatgccattaggtaatc |
152 |
Q |
| |
|
||| || ||||||||||| ||||||| |
|
|
| T |
7751861 |
gaactccaacatgccattgggtaatc |
7751886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 173 - 270
Target Start/End: Original strand, 7752639 - 7752736
Alignment:
| Q |
173 |
tctaccatgggagttccattgttgagccaacaaacacatcagcaagcaagccctcggcagatgagtcaacgaactccgatgagtccgcaacaaatgag |
270 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7752639 |
tctaccatgggagtttcatcgttgagccaacaaacacatcagcaagcaagccctcagcaaatgagtcaacgaactccgatgagtccgcaacagatgag |
7752736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University