View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16741_high_53 (Length: 267)
Name: NF16741_high_53
Description: NF16741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16741_high_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 253
Target Start/End: Complemental strand, 14703553 - 14703313
Alignment:
| Q |
13 |
aatatcacatgtttgagatcttgagcaccgtttatgttttgtactttttgtggaaaaatagaaaagtaataaatagcttttggnnnnnnngggaaatctc |
112 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14703553 |
aatatcacatgtttgagatcttaagcaccgtttatgttttgtactttttgtggaaaaatagaaaagtaataaatagcttttggtttttttgggaaatctc |
14703454 |
T |
 |
| Q |
113 |
gtgatcttttttgccttaaggaaaggtaagtacagtgaccatagaataaggttttatgattcgaatatactataatactacagtgaaaaaattgtaaatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14703453 |
gtgatcttttttgccttaaggaaaggtaagtacagtgaccatagaataaggttttatgattcgaatatactataatactacagtgaaaaatttgtaaatg |
14703354 |
T |
 |
| Q |
213 |
tttattttattataaatgaagaatgttggttattctttttg |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14703353 |
tttattttattataaatgaagaatgttggttattctttttg |
14703313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University