View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16741_high_63 (Length: 242)
Name: NF16741_high_63
Description: NF16741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16741_high_63 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 13036071 - 13035855
Alignment:
| Q |
1 |
ttatttaccgctatcgcttctgtggttattgcttagtcaaaatttgaaactatgagaaactcatggttaggtgaattcatgtttctttaccttagacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13036071 |
ttatttaccgctatcgcttctgtggttattgcttagtcaaaatttgaaactatgagaaactcatggttaggtgaattcatgtttctttaccttagacaaa |
13035972 |
T |
|
| Q |
101 |
tggcaaagttaatcgccatatgattcaaaaattatctaagaaaactttaattatgcaaatttagaaagtgttatggactagatgaaaatgagatatttaa |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13035971 |
tggcaaagttaatcaccatatgattcaaaaattatctaagaaaactttaattatgcaaatttagaaaatgttatggactagatgaaaatgagatatttaa |
13035872 |
T |
|
| Q |
201 |
ttgttcatattattaaa |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13035871 |
ttgttcatattattaaa |
13035855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University