View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16741_high_65 (Length: 240)
Name: NF16741_high_65
Description: NF16741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16741_high_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 40576128 - 40576000
Alignment:
| Q |
1 |
ttgaattttcttacttttcttcatgcaccaaggaatgagatgatacagcatttagaggaagacttttcaatattcgtgaaaaagttgatataagaagggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40576128 |
ttgaattttcttacttttcttcatgcaccaaggaatgagatgatacagcatttagaggaagacttttcaatattcgtgaaaaagttgatataagaagggt |
40576029 |
T |
 |
| Q |
101 |
attgtcgatcaacctagctcatgcttcag |
129 |
Q |
| |
|
|||| |||||||||||||||||||||||| |
|
|
| T |
40576028 |
attgccgatcaacctagctcatgcttcag |
40576000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 188 - 219
Target Start/End: Complemental strand, 40576005 - 40575974
Alignment:
| Q |
188 |
cttcagctcaagtgttgatatacaccagattg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40576005 |
cttcagctcaagtgttgatatacaccagattg |
40575974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University