View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16741_high_72 (Length: 218)
Name: NF16741_high_72
Description: NF16741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16741_high_72 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 30274733 - 30274529
Alignment:
| Q |
1 |
aactgatgaagccaaacaggttttccacttccctcccttctgtttattattgagtttcactatgagagagttttgaaaacaacatgcttctcaatttctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30274733 |
aactgatgaagccaaacaggttttccacttccctcccttctgtttattattgagtttcactatgagag--ttttgaaaacaacatgcttctcaatttctc |
30274636 |
T |
 |
| Q |
101 |
atccattatctttattccttgaacagtttattatggatgtgcaattcctagtggaaattggaatgtatggaggatatttctccactgatcctttacttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30274635 |
atccattatctttattccttgaacagtttattatggatgtgcaattcctagtggaaattggaatgtatggaggatatttctccactgatcctttacttct |
30274536 |
T |
 |
| Q |
201 |
tctcact |
207 |
Q |
| |
|
||||||| |
|
|
| T |
30274535 |
tctcact |
30274529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University