View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16741_low_30 (Length: 411)
Name: NF16741_low_30
Description: NF16741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16741_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 2e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 33 - 208
Target Start/End: Complemental strand, 52873077 - 52872902
Alignment:
| Q |
33 |
agaaatgcaccttgtcagttgaaggagaacaacagtcagcgggaatggaagaaatgagaggagatttgagagattgatcggcaagtttaggcaaaataga |
132 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52873077 |
agaaatgcaccttggaagttgaaggagaacaacagtcagcgggaatggaagaaatgagaggagatttgagagattgatcggcaagtttaggcaaaataga |
52872978 |
T |
|
| Q |
133 |
gccaaatttagcggtcatagcgttaagcatgtcaccttctttgccatcaacccaattcttcactttaacctgtaac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52872977 |
gccaaatttagcggtcatagcgttaagcatgtcgccttctttgccatcaacccaattcttcactttaacctgtaac |
52872902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 263 - 411
Target Start/End: Complemental strand, 52872847 - 52872699
Alignment:
| Q |
263 |
caagtaagaattaccacttgcgtttcgtgattgcatgcggcgttgttgtcatcggcatttgttgttgtgaacatgaagaaggagagaataagaatcttta |
362 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
52872847 |
caagtaagaattaccaattgcgtttcgtgattgcatgcggcgttgttgtcatcggcatttgttgttgggaacatgaagaaggagagaataagaatgtttg |
52872748 |
T |
|
| Q |
363 |
ccaccaagtgcgaaaaccaccgcactattattgttaattcaattcaatt |
411 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
52872747 |
ccaccaagtgcgaaaaccaccgcattattattattaattcaattcaatt |
52872699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University