View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16741_low_37 (Length: 341)
Name: NF16741_low_37
Description: NF16741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16741_low_37 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 21 - 341
Target Start/End: Complemental strand, 338865 - 338542
Alignment:
| Q |
21 |
atataacacgtggcttaatattttgaannnnnnnnnatctcatttggttaatatataatatttcgacagatgtt--ggtgtatagg-gggtaggaaggag |
117 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
338865 |
atataacacatggcttaatattttgaatctttttttatctcatttggttaatatataatatttcgacagatgttttggtgtataggtgggtaggaaggag |
338766 |
T |
|
| Q |
118 |
gcatgcatgtgtggacttaattggagtttctccgcttgtgggtttggagaccgaggctttttctatgtgagttttggggtaaccttcagttggatgatgt |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||| |
|
|
| T |
338765 |
acatgcatgtgtggatttaattggagtttctccgcttgtgggtttggagaccgaggctttttctaggtgagttttggggtagccttcggttggatgatgt |
338666 |
T |
|
| Q |
218 |
cttatttagggtttttgttgtacgaggcgttatttgctatatatgttgtttcaatattttactagtatatgttcgttttgtaaaattaatcggctataaa |
317 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
338665 |
cttatttgaggtttttgttgtacgaggcgttatttgctatatatgttgtttcaatattttactagtatatgttcgttttgtaaaattaaccggctataaa |
338566 |
T |
|
| Q |
318 |
ttttgtcgttgaaaaaattacttt |
341 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
338565 |
ttttgtcgttgaaaaaattacttt |
338542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 105 - 172
Target Start/End: Complemental strand, 54927674 - 54927607
Alignment:
| Q |
105 |
gggtaggaaggaggcatgcatgtgtggacttaattggagtttctccgcttgtgggtttggagaccgag |
172 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| ||||| ||||| || ||||||||||| | ||||||| |
|
|
| T |
54927674 |
gggtaggagggaaacatgcatgtgtggacttgattggggtttccccacttgtgggtttagggaccgag |
54927607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 126 - 178
Target Start/End: Complemental strand, 27715518 - 27715466
Alignment:
| Q |
126 |
gtgtggacttaattggagtttctccgcttgtgggtttggagaccgaggctttt |
178 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||| |||||| ||||||||||| |
|
|
| T |
27715518 |
gtgtggacttaattgggatttttccccttgtgggattggaggccgaggctttt |
27715466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University