View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16741_low_38 (Length: 336)
Name: NF16741_low_38
Description: NF16741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16741_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 15 - 321
Target Start/End: Complemental strand, 10387708 - 10387402
Alignment:
| Q |
15 |
ggagaaaatttagtggaattgttatggctgcgcaagggatttatggtataaagatttgaagggtgtagatgatcaagggaatgatgcatgtaaacctcat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10387708 |
ggagaaaatttagtggaattgttatggctgcgcaagggatttatggtataaagatttgaagggtgtagatgatcaagggaatgatgcatgtaaacctcat |
10387609 |
T |
 |
| Q |
115 |
attgtatttgtggttttt-catggatgctatatttataaacaaataatgctatattttggatattgtaaattcagccaattttagtgtaagaggatttag |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10387608 |
attgtatttgtggttttttcatggatgctatatttataaacaaataatgctatattttggatattgtaaattcagccaattttggtgtaagaggatttag |
10387509 |
T |
 |
| Q |
214 |
attgatgcacgttttaccttccaggctccagcaaatttagggggaaacaataagtgatacttttgtacaattttaactaatataatcctcttatgtctca |
313 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
10387508 |
attgatgcactttttaccttccaggctccagcaaatttagggggaaacaataagtaatacttttgttcaattttaactaatataatcctc-tatgtctca |
10387410 |
T |
 |
| Q |
314 |
tatgtgtc |
321 |
Q |
| |
|
|||||||| |
|
|
| T |
10387409 |
tatgtgtc |
10387402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University