View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16741_low_64 (Length: 249)
Name: NF16741_low_64
Description: NF16741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16741_low_64 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 5e-40; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 10 - 105
Target Start/End: Original strand, 40568994 - 40569089
Alignment:
| Q |
10 |
atatttaattagggcctgaaaggtagacaaattgttagccattaagggttattgtatcaatatgacttctccacactttttagtgggttaaatata |
105 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40568994 |
atatttaattagggcgtgaaaggtagacaaattgttagccgttaagggttgttgtatcaatatgacttctccacactttttagtgggttaaatata |
40569089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 134 - 238
Target Start/End: Original strand, 40576822 - 40576919
Alignment:
| Q |
134 |
gttgcagtgaagcaactacttgacagaaatggaattcatcaagggaacatggtattttgattttgagtcttttgcaccgccttaacttggtcaacttagt |
233 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
40576822 |
gttgcagtgaagcaact---tgacagaaatggaattca---agggaacatggtattttgattttgagtcttttgcaccaccttaactt-gtcaacttagt |
40576914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 40576141 - 40576243
Alignment:
| Q |
1 |
ttgaaagtcatatttaattagggcctgaaaggtagacaaattgttagccattaagggttattgtatcaatatgacttctccacactttttagtgggttaa |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| || ||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
40576141 |
ttgaaagtcatatttaattagtctgtgaaaggtagacaaattgtcagccattaagggttgttatatca--atgtcttctccgcactttttagtgggttaa |
40576238 |
T |
 |
| Q |
101 |
atata |
105 |
Q |
| |
|
||||| |
|
|
| T |
40576239 |
atata |
40576243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 237
Target Start/End: Original strand, 27472500 - 27472547
Alignment:
| Q |
189 |
tttgattttgagtcttttgcaccgccttaacttggtcaacttagtagaa |
237 |
Q |
| |
|
|||||||| |||||||||||| | ||||||||| ||||||||||||||| |
|
|
| T |
27472500 |
tttgatttcgagtcttttgcaactccttaactt-gtcaacttagtagaa |
27472547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 122 - 210
Target Start/End: Complemental strand, 22687169 - 22687086
Alignment:
| Q |
122 |
gcattgcaggttgttgcagtgaagcaactacttgacagaaatggaattcatcaagggaacatggtattttgattttgagtcttttgcac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| | || |||||||||||||||||||||||||||||||| |
|
|
| T |
22687169 |
gcattgcaggttgttgcagtgaagcaact---tgacagaaatggaattca--agggaaacatggtattttgattttgagtcttttgcac |
22687086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University