View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16741_low_73 (Length: 225)

Name: NF16741_low_73
Description: NF16741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16741_low_73
NF16741_low_73
[»] chr1 (2 HSPs)
chr1 (103-207)||(40033686-40033790)
chr1 (25-65)||(40033834-40033874)


Alignment Details
Target: chr1 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 103 - 207
Target Start/End: Complemental strand, 40033790 - 40033686
Alignment:
103 tatctaactatcctaaatgataagaacacatcaaatagaaatgaaattgtaccctaaattgtgcgaaagaaatttaccttgaatgaagttactcagaaac 202  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
40033790 tatctaactatcctaaatgataagaacacatcaaatagaaacgaaattgtaccctaaattgtgagaaagaaatttaccttgaatgaagttactcagaaac 40033691  T
203 cctag 207  Q
    |||||    
40033690 cctag 40033686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 25 - 65
Target Start/End: Complemental strand, 40033874 - 40033834
Alignment:
25 cataaacttaagcataaacattattatcatgatcgaatacg 65  Q
    |||||||||||||||||||||||||||||||||||||||||    
40033874 cataaacttaagcataaacattattatcatgatcgaatacg 40033834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University