View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16741_low_75 (Length: 220)
Name: NF16741_low_75
Description: NF16741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16741_low_75 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 89 - 207
Target Start/End: Complemental strand, 43383282 - 43383170
Alignment:
| Q |
89 |
tccccacccaattccttacgcttcttcttaccagtaacattaacagaatcatctttcatcctgtattgatcaccactactatgatcatcggaccaatttt |
188 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43383282 |
tccccacccaattccttactcttcttcttaccagtaacagta------tcatctttcatcctgtattgatcaccactactatgatcatcggaccaatttt |
43383189 |
T |
|
| Q |
189 |
tatctccacctttcatctc |
207 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
43383188 |
tatctccacctttcatctc |
43383170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 20 - 61
Target Start/End: Complemental strand, 43383342 - 43383301
Alignment:
| Q |
20 |
aatatcttaccacattcagtgcaagtacgagcaatgttgttc |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43383342 |
aatatcttaccacattcagtgcaagtacgagcaatgttgttc |
43383301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 60
Target Start/End: Complemental strand, 25870063 - 25870023
Alignment:
| Q |
20 |
aatatcttaccacattcagtgcaagtacgagcaatgttgtt |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25870063 |
aatatcttaccacattcagtgcaagtacgagcaatgttgtt |
25870023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 170 - 207
Target Start/End: Complemental strand, 25869970 - 25869933
Alignment:
| Q |
170 |
tgatcatcggaccaatttttatctccacctttcatctc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25869970 |
tgatcatcggaccaatttttatctccacctttcatctc |
25869933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 117
Target Start/End: Complemental strand, 25870009 - 25869981
Alignment:
| Q |
89 |
tccccacccaattccttacgcttcttctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25870009 |
tccccacccaattccttacgcttcttctt |
25869981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University